circad | circRNAs associated with diseases

hsa_circ_0075829
Gene	LINC00340	Organism	Human
Genome Locus	chr6:22020567-22056919:+	Build	hg19
Disease	Basal Cell Carcinoma	ICD-10	Malignant neoplasm of skin, unspecified (C44.9)
DBLink	Link to database	PMID	27097056
Experimental Method
Sample Type	Tissues	Comparison	6 nodular basal cell carcinoma (6 BCC), and 6 nonlesional epithelial skin (NLES), serving as control were enrolled in this study
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGCTGTGGAGTCCAAGTGTG Reverse TTGAGAAGGATGTTCAGTAGTAACC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Sand, M, Bechara, FG, Sand, D, Gambichler, T, Hahn, SA, Bromba, M, Stockfleth, E, Hessam, S (2016). Circular RNA expression in basal cell carcinoma. Epigenomics, 8, 5:619-32.